Читаем Goliath полностью

Goliath

Commander Rochelle "Rocky" Jackson is aboard the aircraft carrier USS Ronald Reagan when the "unsinkable" naval vessel and its entire fleet are attacked from the depths and sunk. As Rocky struggles to stay alive, a monstrous mechanical steel stingray surfaces, plowing through the seas it now commands. A U.S. Navy-designed futuristic nuclear stealth submarine the length of a football field in the shape of a giant stingray. Simon Covah, a brilliant scientist whose entire family were the victims of terrorism has hijacked the sub. Believing violence is a disease, Covah aims to use the Goliath and its cache of nuclear weapons to dictate policy to the world regarding the removal of oppressive regimes and nuclear weapons.Could the threat of violence forge a lasting peace?But there is another player in this life-and-death chess match. Unbeknownst to Covah and the Goliath crews, Sorceress, the Goliath's biochemical computer brain has become self-aware.And that computer brain is developing its own agenda.

Стив Альтен

Боевая фантастика18+





EPILOGUE


Copyright Page




Dedicated


to the officers and men, past and present,


of the United States Submarine Force.


And to my sister, Abby,


for inspiring me to write.

“We are on the precipice of the next great leap in computer technology. The chemically assembled electronic nanocomputer, or CAEN, will be billions of times faster than our current PCs and represent the forefront of artificial intelligence.”

—Dr. Elizabeth Goode



“There’s a fine line between right and wrong, freedom and oppression, the best of intentions and the insanity of genocide.”

—Gunnar Wolfe



“History is a bloodbath.”

—Williams James



“No snowflake in an avalanche ever feels responsible.”

—Unknown



PROLOGUE

Identity: Stage One: am small and insignificant, stranded on the vast expanse of nature. I hope I can survive.

—Deepak Chopra







“Come to course zero-nine-zero, ahead one-third. Make ship’s depth fifty meters.”

“Aye, sir, coming to course zero-nine-zero, making ship’s depth fifty meters.”

“Engage computer.”

“Aye, sir, computer engaged.”

010110100100100101101101101001010110100101101010101


001011010101101010101110010101100101010110100101101010


110110111101001010110101011010010101101001010100101

“Mr. Chau. Prepare to bring Sorceress on-line. Flood nutrient womb. Prepare bacteria for injection.”

“Aye, sir. Nutrient womb flooded. Bacteria ready for injection.”

“Inject bacteria into womb. Engage DNA synthesizers.”

“Aye, sir. Injecting bacteria. Engaging DNA synthesizers.”

0101101001011010100101011010 1011010 1 1 0 0 1 0 1 ATCGATC-


GATATACCAG

“Activate sensor orbs. Activate voice recognition and response programs.”

“Aye, sir. Sensor orbs activated. Voice recognition and response programs on-line.”

“Transfer primary ship’s control to computer. Sorceress, this is Covah. Are you on-line?”

AACGTTTGTACCACATTAGGATACACATTAGGATA ACA GT A A


TG C A A

Sorceress, acknowledge.”

ACKNOWLEDGED. SORCERESS ON-LINE.



“The people who get on in this world are the people who get up and look for the circumstances they want, and if they can’t find them—make them.”

—George Bernard Shaw



“Revolutions happen, above all, in the minds of men.”

—Ralph Peters, “Fighting for the Future”



“Do we have to shed blood to reform the current political system? I hope it doesn’t have to come to that. But it might.”

—Timothy J. McVeigh, former Army sergeant who bombed the Murrah Federal Building in Oklahoma City, Oklahoma



“The enemy is in many places. The enemy is not looking to be found. And so you have to design a campaign plan that goes after that kind of enemy … .”

—Colin Powell, U.S. Secretary of State




CHAPTER 1


25 September Atlantic Ocean Seine Abyssal Plain 112 miles southwest of the Strait of Gibraltar

With an expulsion of air and water, the majestic behemoth breaks the surface, her sickle-shaped dorsal fin cutting the waves, her great tail slapping the sea in defiance before slipping back into the froth.

Перейти на страницу:

Похожие книги